<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
   <ui>1476-0711-7-10</ui>
   <ji>1476-0711</ji>
   <fm>
      <dochead>Case report</dochead>
      <bibl>
         <title>
            <p>Fatal bacteremia due to immotile <it>Vibrio cholerae </it>serogroup O21 in Vientiane, Laos &#8211; a case report</p>
         </title>
         <aug>
            <au id="A1">
               <snm>Phetsouvanh</snm>
               <fnm>Rattanaphone</fnm>
               <insr iid="I1"/>
               <email>rphetsouvanh@yahoo.co.uk</email>
            </au>
            <au id="A2">
               <snm>Nakatsu</snm>
               <fnm>Masami</fnm>
               <insr iid="I2"/>
               <email>nakatsu-masami@umin.ac.jp</email>
            </au>
            <au id="A3">
               <snm>Arakawa</snm>
               <fnm>Eiji</fnm>
               <insr iid="I3"/>
               <email>earakawa@nih.go.jp</email>
            </au>
            <au id="A4">
               <snm>Davong</snm>
               <fnm>Viengmone</fnm>
               <insr iid="I1"/>
               <email>viengmon9@yahoo.com</email>
            </au>
            <au id="A5">
               <snm>Vongsouvath</snm>
               <fnm>Manivanh</fnm>
               <insr iid="I1"/>
               <email>manivanh100@hotmail.com</email>
            </au>
            <au id="A6">
               <snm>Lattana</snm>
               <fnm>Olay</fnm>
               <insr iid="I1"/>
               <email>olay@yahoox.uk</email>
            </au>
            <au id="A7">
               <snm>Moore</snm>
               <mi>E</mi>
               <fnm>Catrin</fnm>
               <insr iid="I1"/>
               <insr iid="I4"/>
               <email>catrin@tropmedres.ac</email>
            </au>
            <au id="A8">
               <snm>Nakamura</snm>
               <fnm>Satoshi</fnm>
               <insr iid="I2"/>
               <email>snakamura@ri.imcj.go.jp</email>
            </au>
            <au id="A9" ca="yes">
               <snm>Newton</snm>
               <mi>N</mi>
               <fnm>Paul</fnm>
               <insr iid="I1"/>
               <insr iid="I4"/>
               <email>paul@tropmedres.ac</email>
            </au>
         </aug>
         <insg>
            <ins id="I1">
               <p>Wellcome Trust-Mahosot Hospital-Oxford Tropical Medicine Research Collaboration, Microbiology Laboratory, Mahosot Hospital, Vientiane, Lao PD</p>
            </ins>
            <ins id="I2">
               <p>Department of Appropriate Technology Development and Transfer, Research Institute, International Medical Centre of Japan, Tokyo, Japan</p>
            </ins>
            <ins id="I3">
               <p>Department of Bacteriology, National Institute of Infectious Diseases, Tokyo, Japan</p>
            </ins>
            <ins id="I4">
               <p>Centre for Tropical Medicine, Nuffield Department of Clinical Medicine, Churchill Hospital, University of Oxford, Oxford, UK</p>
            </ins>
         </insg>
         <source>Annals of Clinical Microbiology and Antimicrobials</source>
         <issn>1476-0711</issn>
         <pubdate>2008</pubdate>
         <volume>7</volume>
         <issue>1</issue>
         <fpage>10</fpage>
         <url>http://www.ann-clinmicrob.com/content/7/1/10</url>
         <xrefbib>
            <pubidlist>
               <pubid idtype="pmpid">18439249</pubid>
               <pubid idtype="doi">10.1186/1476-0711-7-10</pubid>
            </pubidlist>
         </xrefbib>
      </bibl>
      <history>
         <rec>
            <date>
               <day>08</day>
               <month>12</month>
               <year>2007</year>
            </date>
         </rec>
         <acc>
            <date>
               <day>25</day>
               <month>4</month>
               <year>2008</year>
            </date>
         </acc>
         <pub>
            <date>
               <day>25</day>
               <month>4</month>
               <year>2008</year>
            </date>
         </pub>
      </history>
      <cpyrt>
         <year>2008</year>
         <collab>Phetsouvanh et al; licensee BioMed Central Ltd.</collab>
         <note>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<url>http://creativecommons.org/licenses/by/2.0</url>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</note>
      </cpyrt>
      <abs>
         <sec>
            <st>
               <p>Abstract</p>
            </st>
            <sec>
               <st>
                  <p>Background</p>
               </st>
               <p>Human infections with non-O1, non-O139 <it>V. cholerae </it>have been described from Laos. Elsewhere, non cholera-toxin producing, non-O1, non-O139 <it>V. cholerae </it>have been described from blood cultures and ascitic fluid, although they are exceedingly rare isolates.</p>
            </sec>
            <sec>
               <st>
                  <p>Case presentation</p>
               </st>
               <p>We describe a farmer who died with <it>Vibrio cholerae </it>O21 bacteremia and peritonitis in Vientiane, Laos, after eating partially cooked apple snails (<it>Pomacea canaliculata</it>) and mussels (<it>Ligumia </it>species). The cultured <it>V. cholerae </it>were non-motile. PCR detected <it>ompW </it>and <it>toxR </it>gene regions but not the <it>ctxA, ompU, omp K </it>and <it>TCP </it>gene regions. Although the organisms lacked flagellae on scanning electron microscopy, they possessed the <it>Vibrio </it>flagellin <it>flaA </it>gene.</p>
            </sec>
            <sec>
               <st>
                  <p>Conclusion</p>
               </st>
               <p>Severe bacteremic non-O1, non-O139 <it>V. cholerae </it>is reported from Laos. The organisms were unusual in being non-motile. They possessed the <it>Vibrio </it>flagellin <it>flaA </it>gene. Further research to determine the reasons for the non-motility and virulence is required.</p>
            </sec>
         </sec>
      </abs>
   </fm>
   <bdy>
      <sec>
         <st>
            <p>Background</p>
         </st>
         <p>Cholera is endemic in Laos and O1 and non-O1 <it>V. cholerae </it>(including serogroups 11, 14, 16, 21, 41, 43, 68 and 169), but not 0139, have been recorded [<abbrgrp><abbr bid="B1">1</abbr><abbr bid="B2">2</abbr></abbrgrp>, Phouthavane <it>et al</it>. unpublished]. Non cholera-toxin producing, non-O1, non-O139 <it>V. cholerae </it>have been described from blood cultures and ascitic fluid, although they are exceedingly rare isolates. Consumption of undercooked shellfish, exposure of open wounds to salt and fresh water, drinking of well water, ascites, cirrhosis, renal failure and haematological malignancies have all been associated with non-O1, non-O139 disease <abbrgrp><abbr bid="B3">3</abbr><abbr bid="B4">4</abbr><abbr bid="B5">5</abbr></abbrgrp>. The mortality of recorded non-O1 bacteraemia is high at 24&#8211;62% <abbrgrp><abbr bid="B6">6</abbr><abbr bid="B7">7</abbr><abbr bid="B8">8</abbr><abbr bid="B9">9</abbr><abbr bid="B10">10</abbr><abbr bid="B11">11</abbr></abbrgrp>. Concurrent infection with organism(s) that may damage the bowel mucosa may predispose patients to <it>V. cholerae </it>non-O1 bacteraemia <abbrgrp><abbr bid="B12">12</abbr></abbrgrp>. Of 28 patients with non-01 <it>V. cholerae </it>bacteremia recorded in Taiwan over 5 years, 95% had ascites and 75% had cirrhosis, perhaps because increased intestinal permeability in cirrhotic patients predisposes them to invasive disease <abbrgrp><abbr bid="B13">13</abbr></abbrgrp>. Unlike O1 biotype El Tor, but like O139 <it>V. cholerae</it>, O21 possess a capsule, which is thought to facilitate survival in the blood stream <abbrgrp><abbr bid="B12">12</abbr></abbrgrp>. <it>V. cholerae </it>01 bacteremia has also been described, but is more rare than non-01 <abbrgrp><abbr bid="B14">14</abbr></abbrgrp>.</p>
      </sec>
      <sec>
         <st>
            <p>Case Presentation</p>
         </st>
         <p>In January 2006, a 20 year old female rice farmer, from Nayxaythong District, on the outskirts of Vientiane City, was admitted to Mahosot Hospital, Vientiane, Lao PDR (Laos) with a 7 day history of abdominal pain, fever, rigors, watery diarrhoea, yellow eyes, leg oedema, anuria and malaena. She had collected many apple snails 'hoy pak kwang' (<it>Pomacea canaliculata) </it>and mussels 'hoy kee' (<it>Ligumia </it>species) from the mud on the edge of a nearby lake and washed them before boiling them for 30 minutes. She ate partially cooked snails as she boiled them and became unwell 7 days later. The fully cooked snails were eaten, with chilli sauce, by another villager who remained well. On admission she was had a fever (39.5&#176;C) with jaundice, abdominal tenderness, splenomegaly, tachycardia, shortness of breath, lower leg oedema and ascites. She had no skin lesions and had no evidence for prior cirrhosis, antacid or steroid use, gastric surgery or haemoglobinopathy. Her haematocrit was 35%, with a peripheral white cell count of 8.9 10<sup>9</sup>/L (66% neutrophils). Serum creatinine, alkaline phosphatase and glucose were within the reference ranges, with raised total serum bilirubin 41 &#956;mol/L (reference &lt;14.5 &#956;mol/L), AST 75 IU/L (&lt;37 IU/L) and ALT 170 IU/L (&lt;40 IU/L). Abdominal ultrasound demonstrated ascites and splenomegaly with normal liver and kidneys. Stool was not cultured. She was treated empirically with intravenous ampicillin, gentamicin and diuretics. Analysis of tapped ascitic fluid revealed many white cells, 90% of which were neutrophils.</p>
         <p>Oxidase positive, curved, non-motile Gram negative rods were grown from 2 of 2 blood cultures, after 2 days incubation and the ascitic fluid, after 1 day of incubation. API 20E (bioMeriuex, France) identified <it>Vibrio cholerae </it>with 99.9% confidence. The organism grew in 0% sodium chloride but not in 6% or 10% sodium chloride and did not agglutinate when tested against O1 and O139 antisera, but did against O21 antisera (Department of Bacteriology, National Institute of Infectious Disease in Tokyo, Japan). By disc diffusion testing (Kerby-Bauer, according to NCCLS guidelines 2003) the organisms were susceptible to ampicillin, ciprofloxacin, ceftriaxone and tetracycline. She was taken home moribund, at her relatives' request, after 2 days in hospital and died soon afterwards.</p>
         <p>In order to investigate whether we could grow 021 <it>V. cholerae </it>from the probable source of infection, in May 2006 specimens of <it>P. canaliculata </it>and <it>Ligumi </it>species were collected from the same lake as above and cultured in TCBS according to the methods of Ottaviani <it>et al</it>. <abbrgrp><abbr bid="B15">15</abbr></abbrgrp>. No <it>V. cholerae </it>were grown but <it>Aeromonas, Enterobacter, Proteus </it>and <it>Escherichia </it>species were identified.</p>
         <p>The PCR techniques of Nandi <it>et al</it>. <abbrgrp><abbr bid="B16">16</abbr></abbrgrp> were used to confirm that the organisms contained the outer membrane protein W (ompW) and regulatory protein (toxR) of <it>Vibrio cholerae </it>and to determine whether they contained cholera toxin (ctxA) and toxin-coregulated pilus (TCP) virulence genes (Table <tblr tid="T1">1</tblr> &amp;<tblr tid="T2">2</tblr>). The bacteria from blood culture and ascitic fluid were re-plated on Modified Drigalski Agar (BTB agar, Eiken Kagaku Co Ltd, Tokyo, Japan) to obtain pure growth and DNA extraction was performed (Wizard, A1120, Promega, WI, USA). Biotype Classic O1 Inaba strain 569B and <it>Vibrio cholerae </it>O21, recovered from a patient with diarrhoea in Vientiane Capital, were used as positive control and reference strains, respectively and compared with human isolates of serogroup O21 109-68 from India (from diarrhoeal stool), and environmental isolate 418-03 from the USA (seawater, Chesapeake Bay, Virginia) (both from National Institute of Infectious Diseases (NIID) Tokyo). Primers of Outer membrane protein W (<it>ompW</it>) were prepared according to <abbrgrp><abbr bid="B16">16</abbr></abbrgrp> and outer membrane protein U (<it>ompU</it>), outer membrane protein K (<it>ompK</it>), toxin-coregulated pilus (TCP), cholerae toxin A (<it>ctx</it>A) and Regulatory protein (<it>tox</it>R) primers were designed (Table <tblr tid="T2">2</tblr>) and DNA amplification performed (i-cycler, BioRad) with analysis using 1.8% agarose gel electrophoresis. <it>V. cholerae </it>O21 cultures from both blood and ascitic fluid from our patient and 109-68 and 418-03 had <it>ompW </it>and <it>toxR </it>gene regions, confirming them to be <it>V. cholerae </it><abbrgrp><abbr bid="B16">16</abbr></abbrgrp>, but had no <it>ctxA, ompU, omp K, TCP </it>gene regions, which were present in the Classic 569B strain (Figure <figr fid="F1">1</figr>, Table <tblr tid="T1">1</tblr>). Scanning electron microscopy (SEM; S-5200, Hitachi, Japan) of the patient's isolate, serogroup O21 109-68 and 418-03 (Figures <figr fid="F2">2</figr>, <figr fid="F3">3</figr>, <figr fid="F4">4</figr>) demonstrated that, although 109-68 and 418-03 did possess flagellae, the organisms isolated from the patient did not. The flagellin regulation gene flaA was demonstrated by PCR in the patient's isolates and 569B with specific oligonucleotide primers (Table <tblr tid="T3">3</tblr>), which we designed based on the work of Klose and Mekalanos <abbrgrp><abbr bid="B17">17</abbr></abbrgrp> who demonstrated that immotility could be caused by mutations in the <it>flaA </it>gene alone.</p>
         <fig id="F1">
            <title>
               <p>Figure 1</p>
            </title>
            <caption>
               <p>Agarose gel electrophoresis analysis of <it>V. cholerae </it>from patient's ascitic fluid culture and blood culture isolates, 109-68, 418-02 and 569B</p>
            </caption>
            <text>
               <p><b>Agarose gel electrophoresis analysis of <it>V. cholerae </it>from patient's ascitic fluid culture and blood culture isolates, 109-68, 418-02 and 569B</b>. Lane M is the 100 bp lambda ladder marker (Toyobo, Japan); lanes 1&#8211;4 are ompW (the primer pairs 1/2, 1/4, 2/4, F/R) and lanes 5&#8211;9 are <it>toxR, ctxA, ompU, ompK </it>and <it>TCP</it>.</p>
            </text>
            <graphic file="1476-0711-7-10-1"/>
         </fig>
         <fig id="F2">
            <title>
               <p>Figure 2</p>
            </title>
            <caption>
               <p>Scanning electron micrograph of an environmental <it>V. cholerae </it>isolate from USA (418-03)</p>
            </caption>
            <text>
               <p>
                  <b>Scanning electron micrograph of an environmental <it>V. cholerae </it>isolate from USA (418-03).</b>
               </p>
            </text>
            <graphic file="1476-0711-7-10-2"/>
         </fig>
         <fig id="F3">
            <title>
               <p>Figure 3</p>
            </title>
            <caption>
               <p>Scanning electron micrograph of a human <it>V. cholerae </it>isolate from India (109-68)</p>
            </caption>
            <text>
               <p>
                  <b>Scanning electron micrograph of a human <it>V. cholerae </it>isolate from India (109-68).</b>
               </p>
            </text>
            <graphic file="1476-0711-7-10-3"/>
         </fig>
         <fig id="F4">
            <title>
               <p>Figure 4</p>
            </title>
            <caption>
               <p>Scanning electron micrograph of <it>V. cholerae </it>organisms cultured from the patient, demonstrating the absence of flagellae</p>
            </caption>
            <text>
               <p>
                  <b>Scanning electron micrograph of <it>V. cholerae </it>organisms cultured from the patient, demonstrating the absence of flagellae.</b>
               </p>
            </text>
            <graphic file="1476-0711-7-10-4"/>
         </fig>
         <tbl id="T1">
            <title>
               <p>Table 1</p>
            </title>
            <caption>
               <p>Summary of the gene regions detected in the patients isolates from ascitic fluid and blood culture compared to the 569B reference organism and serogroup O21 609-68 and 418-03 strains kindly provided by the National Institute of Infectious Diseases, Tokyo, Japan.</p>
            </caption>
            <tblbdy cols="8">
               <r>
                  <c ca="left">
                     <p>Gene</p>
                  </c>
                  <c ca="left">
                     <p>Primer</p>
                  </c>
                  <c ca="left">
                     <p>Product length/bp</p>
                  </c>
                  <c ca="left">
                     <p>Inaba 569B</p>
                  </c>
                  <c ca="left">
                     <p>609-68 India</p>
                  </c>
                  <c ca="left">
                     <p>418-03 USA</p>
                  </c>
                  <c ca="left">
                     <p>Patient's ascitic fluid</p>
                  </c>
                  <c ca="left">
                     <p>Patient's blood culture</p>
                  </c>
               </r>
               <r>
                  <c cspan="8">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>
                        <it>ompW</it>
                     </p>
                  </c>
                  <c ca="left">
                     <p>ompW 1/2</p>
                  </c>
                  <c ca="left">
                     <p>588</p>
                  </c>
                  <c ca="left">
                     <p>+</p>
                  </c>
                  <c ca="left">
                     <p>+</p>
                  </c>
                  <c ca="left">
                     <p>+</p>
                  </c>
                  <c ca="left">
                     <p>+</p>
                  </c>
                  <c ca="left">
                     <p>+</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>
                        <it>ompW</it>
                     </p>
                  </c>
                  <c ca="left">
                     <p>ompW1/4</p>
                  </c>
                  <c ca="left">
                     <p>304</p>
                  </c>
                  <c ca="left">
                     <p>+</p>
                  </c>
                  <c ca="left">
                     <p>+</p>
                  </c>
                  <c ca="left">
                     <p>+</p>
                  </c>
                  <c ca="left">
                     <p>+</p>
                  </c>
                  <c ca="left">
                     <p>+</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>
                        <it>ompW</it>
                     </p>
                  </c>
                  <c ca="left">
                     <p>ompW 2/4</p>
                  </c>
                  <c ca="left">
                     <p>336</p>
                  </c>
                  <c ca="left">
                     <p>+</p>
                  </c>
                  <c ca="left">
                     <p>+</p>
                  </c>
                  <c ca="left">
                     <p>+</p>
                  </c>
                  <c ca="left">
                     <p>+</p>
                  </c>
                  <c ca="left">
                     <p>+</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>
                        <it>ompW</it>
                     </p>
                  </c>
                  <c ca="left">
                     <p>ompW F/R</p>
                  </c>
                  <c ca="left">
                     <p>373</p>
                  </c>
                  <c ca="left">
                     <p>+</p>
                  </c>
                  <c ca="left">
                     <p>-</p>
                  </c>
                  <c ca="left">
                     <p>-</p>
                  </c>
                  <c ca="left">
                     <p>-</p>
                  </c>
                  <c ca="left">
                     <p>-</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>
                        <it>ToxR</it>
                     </p>
                  </c>
                  <c ca="left">
                     <p>Tox F/R</p>
                  </c>
                  <c ca="left">
                     <p>337</p>
                  </c>
                  <c ca="left">
                     <p>+</p>
                  </c>
                  <c ca="left">
                     <p>+</p>
                  </c>
                  <c ca="left">
                     <p>+</p>
                  </c>
                  <c ca="left">
                     <p>+</p>
                  </c>
                  <c ca="left">
                     <p>+</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>
                        <it>ctxA</it>
                     </p>
                  </c>
                  <c ca="left">
                     <p>ctxA F/R</p>
                  </c>
                  <c ca="left">
                     <p>354</p>
                  </c>
                  <c ca="left">
                     <p>+</p>
                  </c>
                  <c ca="left">
                     <p>-</p>
                  </c>
                  <c ca="left">
                     <p>-</p>
                  </c>
                  <c ca="left">
                     <p>-</p>
                  </c>
                  <c ca="left">
                     <p>-</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>
                        <it>ompU</it>
                     </p>
                  </c>
                  <c ca="left">
                     <p>ompU F/R</p>
                  </c>
                  <c ca="left">
                     <p>283</p>
                  </c>
                  <c ca="left">
                     <p>+</p>
                  </c>
                  <c ca="left">
                     <p>-</p>
                  </c>
                  <c ca="left">
                     <p>-</p>
                  </c>
                  <c ca="left">
                     <p>-</p>
                  </c>
                  <c ca="left">
                     <p>-</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>
                        <it>ompK</it>
                     </p>
                  </c>
                  <c ca="left">
                     <p>ompK F/R</p>
                  </c>
                  <c ca="left">
                     <p>310</p>
                  </c>
                  <c ca="left">
                     <p>+</p>
                  </c>
                  <c ca="left">
                     <p>-</p>
                  </c>
                  <c ca="left">
                     <p>-</p>
                  </c>
                  <c ca="left">
                     <p>-</p>
                  </c>
                  <c ca="left">
                     <p>-</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>
                        <it>TCP</it>
                     </p>
                  </c>
                  <c ca="left">
                     <p>TCP F/R</p>
                  </c>
                  <c ca="left">
                     <p>265</p>
                  </c>
                  <c ca="left">
                     <p>+</p>
                  </c>
                  <c ca="left">
                     <p>-</p>
                  </c>
                  <c ca="left">
                     <p>-</p>
                  </c>
                  <c ca="left">
                     <p>-</p>
                  </c>
                  <c ca="left">
                     <p>-</p>
                  </c>
               </r>
            </tblbdy>
            <tblfn>
               <p>Notes. Amplification by was done in a 25 &#956;l reaction mixture containing 3 &#956;l of template DNA, 200 &#956;M of each dNTP, 1X reaction buffer, 1.25 units of Taq polymerase (TaKaRa Ex-Taq), and 0.5 &#956;M of each primers. The initial amplification conditions were one cycle at 95&#176;C for 7 minutes, 35 cycles at 95&#176;C for 30 seconds. 55&#176;C for 30 seconds, and 72&#176;C for 30 seconds; and elongation step of 72&#176;C for 5 minutes. Nested PCR was performed with the same method except that the annealing temperature was 60&#176;C and the template was 2 &#956;l of the first PCR product. Electrophoresis was performed on a 1.8% agarose gel.</p>
            </tblfn>
         </tbl>
         <tbl id="T2">
            <title>
               <p>Table 2</p>
            </title>
            <caption>
               <p>Primers and primer sequences. From reference [16] and this paper</p>
            </caption>
            <tblbdy cols="3">
               <r>
                  <c ca="left">
                     <p>Primer name</p>
                  </c>
                  <c ca="left">
                     <p>Sequence</p>
                  </c>
                  <c ca="left">
                     <p>Accession number if designed in this experiment</p>
                  </c>
               </r>
               <r>
                  <c cspan="3">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>ompW-1</p>
                  </c>
                  <c ca="left">
                     <p>CACCAAGAAGGTGACTTTATTGTG</p>
                  </c>
                  <c ca="left">
                     <p>[16]</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>ompW-2</p>
                  </c>
                  <c ca="left">
                     <p>GAACTTATAACCACCCGCG</p>
                  </c>
                  <c ca="left">
                     <p>[16]</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>ompW-3</p>
                  </c>
                  <c ca="left">
                     <p>CCACCTACCTTTATGGTCC</p>
                  </c>
                  <c ca="left">
                     <p>[16]</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>ompW-4</p>
                  </c>
                  <c ca="left">
                     <p>GGAAAGTCGAATTAGCTTCACC</p>
                  </c>
                  <c ca="left">
                     <p>[16]</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>ompW-F</p>
                  </c>
                  <c ca="left">
                     <p>GTTTTTGAAGTCCTCGCTGCT</p>
                  </c>
                  <c ca="left">
                     <p>NC_002506</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>ompW-R</p>
                  </c>
                  <c ca="left">
                     <p>GCATCTGCACCTGCTTTGTA</p>
                  </c>
                  <c ca="left">
                     <p>NC_002506</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>ctxA-F</p>
                  </c>
                  <c ca="left">
                     <p>TCAGACGGGATTTGTTAGGC</p>
                  </c>
                  <c ca="left">
                     <p>AF463400</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>ctxA-R</p>
                  </c>
                  <c ca="left">
                     <p>CCTGCCAATCCATAACCATC</p>
                  </c>
                  <c ca="left">
                     <p>AF463400</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>toxR-F</p>
                  </c>
                  <c ca="left">
                     <p>GATTAGGCAGCAACGAAAGC</p>
                  </c>
                  <c ca="left">
                     <p>M21249</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>toxR-R</p>
                  </c>
                  <c ca="left">
                     <p>GATGAAGGCACACTGCTTGA</p>
                  </c>
                  <c ca="left">
                     <p>M21249</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>ompU-F</p>
                  </c>
                  <c ca="left">
                     <p>GCTGTAGCAGACCGTGTTGA</p>
                  </c>
                  <c ca="left">
                     <p>NC_002505</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>ompU-R</p>
                  </c>
                  <c ca="left">
                     <p>GGTTTTCCATGCGGTAAGAA</p>
                  </c>
                  <c ca="left">
                     <p>NC_002505</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>ompK-F</p>
                  </c>
                  <c ca="left">
                     <p>GCAACGAACAAAAGCAGTGA</p>
                  </c>
                  <c ca="left">
                     <p>NC_002505</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>ompK-R</p>
                  </c>
                  <c ca="left">
                     <p>ACCAGTTGGTCGAGATTTGG</p>
                  </c>
                  <c ca="left">
                     <p>NC_002505</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>TCP-F</p>
                  </c>
                  <c ca="left">
                     <p>TGGGCAGATATTTGTGGTGA</p>
                  </c>
                  <c ca="left">
                     <p>NC_002505</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>TCP-R</p>
                  </c>
                  <c ca="left">
                     <p>TTTCTGCAACTCCTGTCAACAT</p>
                  </c>
                  <c ca="left">
                     <p>NC_002505</p>
                  </c>
               </r>
            </tblbdy>
         </tbl>
         <tbl id="T3">
            <title>
               <p>Table 3</p>
            </title>
            <caption>
               <p>Primers used for PCR of the flaA gene of <it>V. cholerae </it>(designed using <it>V. cholerae </it>accession number AF007121 and the JustBio primer soft software)</p>
            </caption>
            <tblbdy cols="3">
               <r>
                  <c ca="left">
                     <p>Primer name</p>
                  </c>
                  <c ca="left">
                     <p>Sequence</p>
                  </c>
                  <c ca="center">
                     <p>Product length (bp)</p>
                  </c>
               </r>
               <r>
                  <c cspan="3">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>FlaA_F1</p>
                  </c>
                  <c ca="left">
                     <p>GACCGCACAACGTTATCTGA</p>
                  </c>
                  <c ca="center">
                     <p>321</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>FlaA_R1</p>
                  </c>
                  <c ca="left">
                     <p>AGTGCCACCGACTCTTCATT</p>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>FlaA_F2</p>
                  </c>
                  <c ca="left">
                     <p>AACCGTATCGCTGAAACCAC</p>
                  </c>
                  <c ca="center">
                     <p>323</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>FlaA_R2</p>
                  </c>
                  <c ca="left">
                     <p>TCCGTTTGACCGTTGATGTA</p>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>FlaA_F3</p>
                  </c>
                  <c ca="left">
                     <p>AAGCTTCGGTTGACCAAGAA</p>
                  </c>
                  <c ca="center">
                     <p>338</p>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>FlaA_R3</p>
                  </c>
                  <c ca="left">
                     <p>TCCTTCGCAAAATCCGTATC</p>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
            </tblbdy>
         </tbl>
         <p>The 021 <it>V. cholerae </it>cultured from blood and ascitic fluid of our patient were non-motile. <it>V. cholerae </it>are normally motile, although non-motile variants of Classical O1 may arise in the laboratory <abbrgrp><abbr bid="B17">17</abbr><abbr bid="B18">18</abbr></abbrgrp> and non-01 non-motile clinical isolates have been described <abbrgrp><abbr bid="B19">19</abbr></abbrgrp>. The combination of SEM and PCR demonstrated that the organisms lacked flagellae but did possess the important regulatory flagellin gene <it>flaA </it>on the genome. The underlying reasons for the absence of flagellae in the patient's isolates are being investigated.</p>
         <p>Non-01 <it>V. cholerae </it>bacteremia has been described from Thailand <abbrgrp><abbr bid="B9">9</abbr><abbr bid="B20">20</abbr></abbrgrp> and recently from Laos (Phouthavane <it>et al</it>. unpublished). Our patient may have contracted the infection from the molluscs or from injuries whilst walking barefoot on the edge of the lake. An association between <it>V. cholerae </it>and non-biting chironomid midges (Diptera; Chironomidae) egg masses, which live in fresh water, has been described <abbrgrp><abbr bid="B21">21</abbr></abbrgrp> and such midges may be important in the ecology of cholera. The collection and consumption of snails are an important part of life in Laos, as in rural communities in Australia and USA where non O1 <it>V. cholerae </it>bacteremia has been described amongst people who fish <abbrgrp><abbr bid="B22">22</abbr></abbrgrp>. <it>V. cholerae </it>are usually associated with water of medium salinity as it requires trace amounts of sodium chloride for growth but it can be contracted from fresh water environments <abbrgrp><abbr bid="B4">4</abbr><abbr bid="B8">8</abbr></abbrgrp>. Although non-01 and non-0139 <it>V. cholerae </it>are not usually associated with epidemics, in Bangladesh non-01 <it>V. cholerae </it>has caused outbreaks <abbrgrp><abbr bid="B23">23</abbr></abbrgrp>. The optimum treatment remains uncertain but third generation cephalosporins, doxycycline and fluoroquinolones have been suggested <abbrgrp><abbr bid="B3">3</abbr></abbrgrp>.</p>
      </sec>
      <sec>
         <st>
            <p>Conclusion</p>
         </st>
         <p>Fatal bacteremic non-O1, non-O139 <it>V. cholerae </it>is reported from Laos. The organisms were unusual in being non-motile. They did however possess the <it>Vibrio </it>flagellin <it>flaA </it>gene. Further research on the determinants of the non-motility is required. Given the importance of fishing and water in Lao society and the high prevalence of cirrhosis secondary to hepatitis B and C infection <abbrgrp><abbr bid="B24">24</abbr></abbrgrp>, <it>V. cholerae </it>non-01 bacteraemia may be a more important disease than this case report suggests.</p>
      </sec>
      <sec>
         <st>
            <p>Competing interests</p>
         </st>
         <p>The authors declare that they have no competing interests.</p>
      </sec>
      <sec>
         <st>
            <p>Authors' contributions</p>
         </st>
         <p>RP was in charge of diagnosis and edited the ms, MN performed PCR assays and helped write ms, EA performed diagnosis work up and SEM, and edited ms, VD, MV and OL performed diagnosis work up and edited ms, CEM assisted with diagnostic workup, reviewed molecular analysis and edited ms, SN performed diagnosis workup and helped write ms and PNN assisted with diagnostic workup, wrote the first draft and edited ms. All authors read and approved the final manuscript.</p>
      </sec>
   </bdy>
   <bm>
      <ack>
         <sec>
            <st>
               <p>Acknowledgements</p>
            </st>
            <p>We are very grateful to the family of the patient for their help and to the Minister of Health, His Excellency Dr Ponmek Dalaloy and the Director of the Curative Department, Ministry of Health, Professor Sommone Phounsavath for their support for this study, which was part of the Wellcome Trust-Mahosot Hospital-Oxford Tropical Medicine Research Collaboration and the 'Sustainable Co-existence of Humans, Nature and the Earth' project of Research Revolution 2002, Government of Japan. We thank Dr Sinthavong Vilavong and Mr Lienag Khamsivilay of the Fisheries Research Centre, Ministry of Agriculture and Forestry, Government of the Lao PDR, for kindly determining the identity of the mollusks and anonymous reviewers and Dr Sharon Peacock for their advice. Written informed consent was obtained from the patient's relative for publication of this study.</p>
            <p><b>Financial Support</b>. Wellcome Trust of Great Britain (RP, VD, MV, OL, CEM, PNN) and Ministry of Education, Culture, Science, Sports and Technology, Japan (MN, EA, SN).</p>
         </sec>
      </ack>
      <refgrp>
         <bibl id="B1">
            <title>
               <p>Bacterial diarrhea in Laos, a region where cholera was endemic</p>
            </title>
            <aug>
               <au>
                  <snm>Midorikawa</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Nakamura</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Iwade</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Sugiyama</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Sisavath</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Phakhounthong</snm>
                  <fnm>R</fnm>
               </au>
            </aug>
            <source>Southeast Asian J Trop Med Public Health</source>
            <pubdate>1996</pubdate>
            <volume>27</volume>
            <fpage>724</fpage>
            <lpage>7</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid">9253874</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B2">
            <title>
               <p><it>Vibrio cholerae </it>SXT element, Laos</p>
            </title>
            <aug>
               <au>
                  <snm>Toma</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Nakasone</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Song</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Iwanaga</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Emerg Infect Dis</source>
            <pubdate>2005</pubdate>
            <volume>11</volume>
            <fpage>346</fpage>
            <lpage>7</lpage>
            <xrefbib>
               <pubid idtype="pmpid">15759340</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B3">
            <title>
               <p>Bacteremic cellulitis caused by Non-O1, Non-O139 Vibrio cholerae: report of a case in a patient with hemochromatosis</p>
            </title>
            <aug>
               <au>
                  <snm>Fernandez</snm>
                  <fnm>JM</fnm>
               </au>
               <au>
                  <snm>Serrano</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>De Arriba</snm>
                  <fnm>JJ</fnm>
               </au>
               <au>
                  <snm>Sanchez</snm>
                  <fnm>MV</fnm>
               </au>
               <au>
                  <snm>Escribano</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Ferreras</snm>
                  <fnm>P</fnm>
               </au>
            </aug>
            <source>Diagn Microbiol Infect Dis</source>
            <pubdate>2000</pubdate>
            <volume>37</volume>
            <fpage>77</fpage>
            <lpage>80</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0732-8893(99)00153-4</pubid>
                  <pubid idtype="pmpid" link="fulltext">10794945</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B4">
            <title>
               <p>Non-O:1 <it>Vibrio cholerae </it>bacteremia</p>
            </title>
            <aug>
               <au>
                  <snm>Rabadan</snm>
                  <fnm>PM</fnm>
               </au>
               <au>
                  <snm>Vilalta</snm>
                  <fnm>E</fnm>
               </au>
            </aug>
            <source>Rev Infect Dis</source>
            <pubdate>1989</pubdate>
            <volume>11</volume>
            <fpage>667</fpage>
            <xrefbib>
               <pubid idtype="pmpid">2638813</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B5">
            <title>
               <p>The characterisation of <it>Vibrio cholerae </it>Non-O1 strain causing perforative pan-peritonitis</p>
            </title>
            <aug>
               <au>
                  <snm>Ichinose</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Ehara</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Shimizu</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Ohmagari</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Kaku</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Hara</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Tsuji</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Simada</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>Jap J Inf Dis</source>
            <pubdate>2001</pubdate>
            <volume>75</volume>
            <issue>8</issue>
            <fpage>696</fpage>
            <lpage>702</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid">11558133</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B6">
            <title>
               <p>Primary septicemia caused by <it>Vibrio cholerae </it>non-O1 acquired on Cape Cod, Massachusetts</p>
            </title>
            <aug>
               <au>
                  <snm>Kontoyiannis</snm>
                  <fnm>DP</fnm>
               </au>
               <au>
                  <snm>Calia</snm>
                  <fnm>KE</fnm>
               </au>
               <au>
                  <snm>Basgoz</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>Calderwood</snm>
                  <fnm>SB</fnm>
               </au>
            </aug>
            <source>Clin Infect Dis</source>
            <pubdate>1995</pubdate>
            <volume>21</volume>
            <issue>5</issue>
            <fpage>1330</fpage>
            <lpage>3</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid">8589171</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B7">
            <title>
               <p>A cytotoxin-producing strain of <it>Vibrio cholerae </it>non-O1, non-O139 as a cause of cholera and bacteremia after consumption of raw clams</p>
            </title>
            <aug>
               <au>
                  <snm>Namdari</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Klaips</snm>
                  <fnm>CR</fnm>
               </au>
               <au>
                  <snm>Hughes</snm>
                  <fnm>JL</fnm>
               </au>
            </aug>
            <source>J Clin Microbiol</source>
            <pubdate>2000</pubdate>
            <volume>38</volume>
            <fpage>3518</fpage>
            <lpage>3519</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">87425</pubid>
                  <pubid idtype="pmpid" link="fulltext">10970422</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B8">
            <title>
               <p>Non-O1 Vibrio cholerae septicemia: case report, discussion of literature, and relevance to bioterrorism</p>
            </title>
            <aug>
               <au>
                  <snm>Anderson</snm>
                  <fnm>AM</fnm>
               </au>
               <au>
                  <snm>Varkey</snm>
                  <fnm>JB</fnm>
               </au>
               <au>
                  <snm>Petti</snm>
                  <fnm>CA</fnm>
               </au>
               <au>
                  <snm>Liddle</snm>
                  <fnm>RA</fnm>
               </au>
               <au>
                  <snm>Frothingham</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Woods</snm>
                  <fnm>CW</fnm>
               </au>
            </aug>
            <source>Diagn Microbiol Infect Dis</source>
            <pubdate>2004</pubdate>
            <volume>49</volume>
            <fpage>295</fpage>
            <lpage>7</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.diagmicrobio.2004.04.016</pubid>
                  <pubid idtype="pmpid" link="fulltext">15313536</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B9">
            <title>
               <p>Non-serogroup O:1 <it>Vibrio cholerae </it>bacteremia and cerebritis</p>
            </title>
            <aug>
               <au>
                  <snm>Suankratay</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Phantumchinda</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Tachawiboonsak</snm>
                  <fnm>W</fnm>
               </au>
               <au>
                  <snm>Wilde</snm>
                  <fnm>H</fnm>
               </au>
            </aug>
            <source>Clin Infect Dis</source>
            <pubdate>2001</pubdate>
            <volume>32</volume>
            <issue>7</issue>
            <fpage>117</fpage>
            <lpage>119</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1086/319596</pubid>
                  <pubid idtype="pmpid" link="fulltext">11264049</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B10">
            <title>
               <p>Toxigenic <it>Vibrio cholerae </it>serogroup O141-associated cholera-like diarrhoea and blood stream infection in the United States</p>
            </title>
            <aug>
               <au>
                  <snm>Crump</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Bopp</snm>
                  <fnm>CA</fnm>
               </au>
               <au>
                  <snm>Greene</snm>
                  <fnm>KD</fnm>
               </au>
               <au>
                  <snm>Kubota</snm>
                  <fnm>KA</fnm>
               </au>
               <au>
                  <snm>Middendorf</snm>
                  <fnm>RL</fnm>
               </au>
               <au>
                  <snm>Wells</snm>
                  <fnm>JG</fnm>
               </au>
               <au>
                  <snm>Mintz</snm>
                  <fnm>ED</fnm>
               </au>
            </aug>
            <source>J Infect Dis</source>
            <pubdate>2003</pubdate>
            <volume>187</volume>
            <fpage>866</fpage>
            <lpage>867</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1086/368330</pubid>
                  <pubid idtype="pmpid" link="fulltext">12599062</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B11">
            <title>
               <p>A fatal non-O1 <it>Vibrio cholerae </it>septicemia in a patient with liver cirrhosis</p>
            </title>
            <aug>
               <au>
                  <snm>Eltahawy</snm>
                  <fnm>AT</fnm>
               </au>
               <au>
                  <snm>Jiman-Fatani</snm>
                  <fnm>AA</fnm>
               </au>
               <au>
                  <snm>al-Alawi</snm>
                  <fnm>MM</fnm>
               </au>
            </aug>
            <source>Saudi Med J</source>
            <pubdate>2004</pubdate>
            <volume>25</volume>
            <fpage>1730</fpage>
            <lpage>31</lpage>
            <xrefbib>
               <pubid idtype="pmpid">15573214</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B12">
            <title>
               <p>Septicemia due to <it>Vibrio cholerae </it>O139 Bengal</p>
            </title>
            <aug>
               <au>
                  <snm>Khan</snm>
                  <fnm>AM</fnm>
               </au>
               <au>
                  <snm>Albert</snm>
                  <fnm>MJ</fnm>
               </au>
               <au>
                  <snm>Sarker</snm>
                  <fnm>SA</fnm>
               </au>
               <au>
                  <snm>Bhattacharya</snm>
                  <fnm>MK</fnm>
               </au>
               <au>
                  <snm>Azad</snm>
                  <fnm>AK</fnm>
               </au>
            </aug>
            <source>Diagn Microbiol Infect Dis</source>
            <pubdate>1995</pubdate>
            <volume>22</volume>
            <fpage>337</fpage>
            <lpage>8</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/0732-8893(95)00140-4</pubid>
                  <pubid idtype="pmpid" link="fulltext">8582139</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B13">
            <title>
               <p>Non-O1 <it>Vibrio cholerae </it>bacteremia in patients with cirrhosis: 5-yr experience from a single medical center</p>
            </title>
            <aug>
               <au>
                  <snm>Lin</snm>
                  <fnm>CJ</fnm>
               </au>
               <au>
                  <snm>Chiu</snm>
                  <fnm>CT</fnm>
               </au>
               <au>
                  <snm>Lin</snm>
                  <fnm>DY</fnm>
               </au>
               <au>
                  <snm>Sheen</snm>
                  <fnm>IS</fnm>
               </au>
               <au>
                  <snm>Lien</snm>
                  <fnm>JM</fnm>
               </au>
            </aug>
            <source>Am J Gastroenterol</source>
            <pubdate>1996</pubdate>
            <volume>91</volume>
            <fpage>336</fpage>
            <lpage>4</lpage>
            <xrefbib>
               <pubid idtype="pmpid">8607503</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B14">
            <title>
               <p>Nontoxigenic <it>Vibrio cholerae </it>O1 bacteremia: case report and review</p>
            </title>
            <aug>
               <au>
                  <snm>Ninin</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Caroff</snm>
                  <fnm>N</fnm>
               </au>
               <au>
                  <snm>El Kouri</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Espaze</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Richet</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Quilici</snm>
                  <fnm>ML</fnm>
               </au>
               <au>
                  <snm>Fournier</snm>
                  <fnm>JM</fnm>
               </au>
            </aug>
            <source>Eur J Clin Microbiol Infect Dis</source>
            <pubdate>2000</pubdate>
            <volume>19</volume>
            <fpage>489</fpage>
            <lpage>91</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1007/s100960000296</pubid>
                  <pubid idtype="pmpid" link="fulltext">10947231</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B15">
            <title>
               <p>A biochemical protocol for the isolation and identification of current species of <it>Vibrio </it>in seafood</p>
            </title>
            <aug>
               <au>
                  <snm>Ottaviani</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Masini</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Bacchiocchi</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>J Appl Microbiol</source>
            <pubdate>2003</pubdate>
            <volume>95</volume>
            <fpage>1277</fpage>
            <lpage>84</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1046/j.1365-2672.2003.02105.x</pubid>
                  <pubid idtype="pmpid" link="fulltext">14633002</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B16">
            <title>
               <p>Rapid method for species-specific identification of <it>Vibrio cholerae </it>using primers targeted to the gene of outer membrane protein OmpW</p>
            </title>
            <aug>
               <au>
                  <snm>Nandi</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Nandy</snm>
                  <fnm>RK</fnm>
               </au>
               <au>
                  <snm>Mukhopadhyay</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Nair</snm>
                  <fnm>GB</fnm>
               </au>
               <au>
                  <snm>Shimada</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Ghose</snm>
                  <fnm>AC</fnm>
               </au>
            </aug>
            <source>J Clin Microbiol</source>
            <pubdate>2000</pubdate>
            <volume>38</volume>
            <fpage>4145</fpage>
            <lpage>4151</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">87555</pubid>
                  <pubid idtype="pmpid" link="fulltext">11060082</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B17">
            <title>
               <p>Differential regulation of multiple flagellins in <it>Vibrio cholerae</it></p>
            </title>
            <aug>
               <au>
                  <snm>Klose</snm>
                  <fnm>KE</fnm>
               </au>
               <au>
                  <snm>Mekalanos</snm>
                  <fnm>JJ</fnm>
               </au>
            </aug>
            <source>J Bacteriol</source>
            <pubdate>1998</pubdate>
            <volume>180</volume>
            <issue>2</issue>
            <fpage>303</fpage>
            <lpage>16</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid" link="fulltext">9440520</pubid>
                  <pubid idtype="pmcid">106886</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B18">
            <title>
               <p>High-frequency spontaneous mutation of classical <it>Vibrio cholerae </it>to a nonmotile phenotype</p>
            </title>
            <aug>
               <au>
                  <snm>Mostow</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Richardson</snm>
                  <fnm>K</fnm>
               </au>
            </aug>
            <source>Infect Immun</source>
            <pubdate>1990</pubdate>
            <volume>58</volume>
            <fpage>3633</fpage>
            <lpage>9</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">313708</pubid>
                  <pubid idtype="pmpid" link="fulltext">2228234</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B19">
            <title>
               <p>Virulence mechanisms associated with clinical isolates of non-O1 <it>Vibrio cholerae</it></p>
            </title>
            <aug>
               <au>
                  <snm>Shehabi</snm>
                  <fnm>AA</fnm>
               </au>
               <au>
                  <snm>Drexler</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Richardson</snm>
                  <fnm>SH</fnm>
               </au>
            </aug>
            <source>Zentrabl Bakteriol Mikrobiol Hyg [A]</source>
            <pubdate>1986</pubdate>
            <volume>261</volume>
            <issue>2</issue>
            <fpage>232</fpage>
            <lpage>9</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmpid">3739461</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B20">
            <title>
               <p>Non-0=O1 <it>Vibrio cholerae </it>septicemia: a case report</p>
            </title>
            <aug>
               <au>
                  <snm>Thisyakorn</snm>
                  <fnm>U</fnm>
               </au>
               <au>
                  <snm>Reinprayoon</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>Southeast Asian J Trop Med Public Health</source>
            <pubdate>1990</pubdate>
            <volume>21</volume>
            <fpage>149</fpage>
            <lpage>50</lpage>
            <xrefbib>
               <pubid idtype="pmpid">2402675</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B21">
            <title>
               <p>Chironomid egg masses as a natural reservoir of <it>Vibrio cholerae </it>non-O1 and non-O139 in freshwater habitats</p>
            </title>
            <aug>
               <au>
                  <snm>Halpern</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Broza</snm>
                  <fnm>YB</fnm>
               </au>
               <au>
                  <snm>Mittler</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Arakawa</snm>
                  <fnm>E</fnm>
               </au>
               <au>
                  <snm>Broza</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Microb Ecol</source>
            <pubdate>2004</pubdate>
            <volume>47</volume>
            <fpage>341</fpage>
            <lpage>9</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1007/s00248-003-2007-6</pubid>
                  <pubid idtype="pmpid" link="fulltext">14681736</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B22">
            <title>
               <p>Non-O1 <it>Vibrio cholerae</it>: a fatal cause of sepsis in northern Australia</p>
            </title>
            <aug>
               <au>
                  <snm>Heath</snm>
                  <fnm>CH</fnm>
               </au>
               <au>
                  <snm>Garrow</snm>
                  <fnm>SC</fnm>
               </au>
               <au>
                  <snm>Golledge</snm>
                  <fnm>CL</fnm>
               </au>
            </aug>
            <source>Med J Aust</source>
            <pubdate>2001</pubdate>
            <volume>174</volume>
            <fpage>480</fpage>
            <lpage>1</lpage>
            <xrefbib>
               <pubid idtype="pmpid">11386599</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B23">
            <title>
               <p>Large outbreak of clinical cholera due to <it>Vibrio cholerae </it>non-O1 in Bangladesh</p>
            </title>
            <aug>
               <au>
                  <snm>Albert</snm>
                  <fnm>MJ</fnm>
               </au>
               <au>
                  <snm>Siddique</snm>
                  <fnm>AK</fnm>
               </au>
               <au>
                  <snm>Islam</snm>
                  <fnm>MS</fnm>
               </au>
               <au>
                  <snm>Faruque</snm>
                  <fnm>AS</fnm>
               </au>
               <au>
                  <snm>Ansaruzzaman</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Faruque</snm>
                  <fnm>SM</fnm>
               </au>
               <au>
                  <snm>Sack</snm>
                  <fnm>RB</fnm>
               </au>
            </aug>
            <source>Lancet</source>
            <pubdate>1993</pubdate>
            <volume>341</volume>
            <fpage>704</fpage>
            <xrefbib>
               <pubid idtype="pmpid">8095621</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B24">
            <title>
               <p>Seroprevalence of hepatitis B and C virus infections among Lao blood donors</p>
            </title>
            <aug>
               <au>
                  <snm>Jutavijittum</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Yousukh</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Samountry</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Samountry</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Ounavong</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Thammavong</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Keokhamphue</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Toriyama</snm>
                  <fnm>K</fnm>
               </au>
            </aug>
            <source>Southeast Asian J Trop Med Public Health</source>
            <pubdate>2007</pubdate>
            <volume>38</volume>
            <fpage>674</fpage>
            <lpage>9</lpage>
            <xrefbib>
               <pubid idtype="pmpid">17883005</pubid>
            </xrefbib>
         </bibl>
      </refgrp>
   </bm>
</art>
